zgc:162344

Ensembl ID:
ENSDARG00000070040
ZFIN ID:
ZDB-GENE-030131-6058
Description:
hypothetical protein LOC563289 [Source:RefSeq peptide;Acc:NP_001077305]
Human Orthologue:
KIAA1328
Human Description:
KIAA1328 [Source:HGNC Symbol;Acc:29248]
Mouse Orthologue:
AW554918
Mouse Description:
expressed sequence AW554918 Gene [Source:MGI Symbol;Acc:MGI:2147376]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23876 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23876
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102463 Nonsense 166 578 5 11
ENSDART00000125380   None 247 None 5

The following transcripts of ENSDARG00000070040 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 10465476)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 11948839
GRCz11 21 12041467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCAGGGATGAACAGGAAACCTTTGAGAAAAGAATCCAACAGCTAGAG[C/T]AGCAAAACCAACTCATTATAGAAGAGAGAGGAAGTATCCTTTTATTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link