zgc:153269

Ensembl ID:
ENSDARG00000070021
ZFIN ID:
ZDB-GENE-060929-96
Description:
hypothetical protein LOC558541 [Source:RefSeq peptide;Acc:NP_001071016]
Human Orthologues:
CYP3A4, CYP3A43, CYP3A5, CYP3A7
Human Descriptions:
cytochrome P450, family 3, subfamily A, polypeptide 4 [Source:HGNC Symbol;Acc:2637]
cytochrome P450, family 3, subfamily A, polypeptide 43 [Source:HGNC Symbol;Acc:17450]
cytochrome P450, family 3, subfamily A, polypeptide 5 [Source:HGNC Symbol;Acc:2638]
cytochrome P450, family 3, subfamily A, polypeptide 7 [Source:HGNC Symbol;Acc:2640]
Mouse Orthologues:
Cyp3a11, Cyp3a13, Cyp3a16, Cyp3a25, Cyp3a41a, Cyp3a41b, Cyp3a44, Cyp3a57, Cyp3a59
Mouse Descriptions:
cytochrome P450, family 3, subfamily a, polypeptide 11 Gene [Source:MGI Symbol;Acc:MGI:88609]
cytochrome P450, family 3, subfamily a, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:88610]
cytochrome P450, family 3, subfamily a, polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:106099]
cytochrome P450, family 3, subfamily a, polypeptide 25 Gene [Source:MGI Symbol;Acc:MGI:1930638]
cytochrome P450, family 3, subfamily a, polypeptide 41A Gene [Source:MGI Symbol;Acc:MGI:1858451]
cytochrome P450, family 3, subfamily a, polypeptide 41B Gene [Source:MGI Symbol;Acc:MGI:3714859]
cytochrome P450, family 3, subfamily a, polypeptide 44 Gene [Source:MGI Symbol;Acc:MGI:2449818]
cytochrome P450, family 3, subfamily a, polypeptide 57 Pseudogene [Source:MGI Symbol;Acc:MGI:3646373
cytochrome P450, subfamily 3A, polypeptide 59 Gene [Source:MGI Symbol;Acc:MGI:3769707]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20101 Nonsense Available for shipment Available now
sa45151 Nonsense Mutation detected in F1 DNA During 2018
sa33275 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102416 Nonsense 57 507 3 13
ENSDART00000138719 Nonsense 57 505 3 13
Genomic Location (Zv9):
Chromosome 3 (position 40938401)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40801761
GRCz11 3 40943619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTTTTCCCTTTCATTTAATAATCGACTGTGTATTTTAGGGTTTGTG[C/A]AATTTTGATATGGAGTGTGCTAAGAAGTATGGAAAAGTTTGGGGGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102416 Nonsense 415 507 11 13
ENSDART00000138719 Nonsense 413 505 11 13
Genomic Location (Zv9):
Chromosome 3 (position 40932339)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40795699
GRCz11 3 40937557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCTTGTTGGAATTCCTACATATGTTTTAAGTCATGACCCGGATATCT[G/A]GGAGTCTCCTGGAGAGTTCAGGCCGGAGAGGTGATGTTTGTCATTTCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102416 Nonsense 498 507 13 13
ENSDART00000138719 Nonsense 496 505 13 13
Genomic Location (Zv9):
Chromosome 3 (position 40931634)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 40794994
GRCz11 3 40936852
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGAAATTAATGTTACATTTCAACCGAAGGTTCCCATCACACTCAAGT[T/G]AATACCAAGATCTTGCAATAAAAAGCAATAATTCTGGTCAAAAACAGATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link