zgc:162502

Ensembl ID:
ENSDARG00000070017
ZFIN ID:
ZDB-GENE-070424-33
Description:
cytochrome P450 [Source:RefSeq peptide;Acc:NP_001020728]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3216 Essential Splice Site Available for shipment Available now
sa18314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102388 Essential Splice Site 65 498 1 9
Genomic Location (Zv9):
Chromosome 23 (position 42881884)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42469075
GRCz11 23 42434571
KASP Assay ID:
554-2603.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGAAACTTACCACATTTCTTGAAGAGCCCAATGGAGTTCATAAGATCC[G/A]TAAGTCTTTGCTGGTTTCTTGGTTGGGGTTTAACATTTAAATGTTRTTAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa18314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102388 Nonsense 267 498 5 9
Genomic Location (Zv9):
Chromosome 23 (position 42874634)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42476325
GRCz11 23 42441821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCGAGACGAAGCTAAAGAACACAAACAAACTCTGGATCCAGRCAGTCCA[C/T]GAGACTTCATTGATGCMTATCTACTRGAGATCGAGAAAGTGAGATCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link