
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rcn1
- Ensembl ID:
- ENSDARG00000070006
- ZFIN ID:
- ZDB-GENE-080225-33
- Human Orthologue:
- RCN1
- Human Description:
- reticulocalbin 1, EF-hand calcium binding domain [Source:HGNC Symbol;Acc:9934]
- Mouse Orthologue:
- Rcn1
- Mouse Description:
- reticulocalbin 1 Gene [Source:MGI Symbol;Acc:MGI:104559]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25356 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa45271 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20882 | Nonsense | Available for shipment | Available now |
sa1699 | Essential Splice Site | F2 line generated | During 2018 |
sa20881 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa25356
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102363 | Nonsense | 124 | 328 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16595617)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15578315 GRCz11 7 15826201 - KASP Assay ID:
- 554-7505.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTCAGAAGCGCTACGTTTATGAGAACGTTGCAAAAGTCTGGACTGACTA[T/A]GACCTGAACAAAGACAACAAGATCTCTTGGGATGAATACAAGCAGGCGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45271
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102363 | Nonsense | 225 | 328 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16595082)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15577780 GRCz11 7 15825666 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGGAAGACATTGACAAAAATGGCGATGGTCATGTCGATGAAGATGAATA[C/A]ATTGGTAGGTGCTGATGTATTTTTGTGTGACCAATAGAATGCACCATAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20882
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102363 | Nonsense | 273 | 328 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16592575)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15575273 GRCz11 7 15823159 - KASP Assay ID:
- 2259-8550.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAAAGATGGGAAGATGGACCTAGAAGAGATTCGTCACTGGATCCTGCCA[C/T]AGGACTATGATCACGCACAGGCAGAAGCCAGACATCTGGTGTACGAGTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1699
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102363 | Essential Splice Site | 293 | 328 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16592511)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15575209 GRCz11 7 15823095 - KASP Assay ID:
- 554-1645.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGCACAGGCAGAAGCCAGACATCTGGTGTACGAGTCAGACACAGACAAAG[T/A]AAGAACGGGCTAGGATACTGTTAAGAATGGTTTCYAAAACAACCTTGTAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20881
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000102363 | Nonsense | 317 | 328 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 16589048)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 15571746 GRCz11 7 15819632 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGATACTTGAGAACTGGAACATGTTTGTTGGCAGCCAAGCCACCAACTA[C/A]GGTGAAGACCTTACCAGGAACCACGATGAGCTCTGAGCCCAACTGACCTC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: