zgc:153638

Ensembl ID:
ENSDARG00000069996
ZFIN ID:
ZDB-GENE-061110-138
Description:
dnaJ homolog subfamily B member 14 [Source:RefSeq peptide;Acc:NP_001071255]
Human Orthologue:
DNAJB14
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 14 [Source:HGNC Symbol;Acc:25881]
Mouse Orthologue:
Dnajb14
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 14 Gene [Source:MGI Symbol;Acc:MGI:1917854]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6592 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39625 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6592
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102337 Essential Splice Site 45 380 2 8
Genomic Location (Zv9):
Chromosome 1 (position 26845767)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27182912
GRCz11 1 27876626
KASP Assay ID:
554-4979.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGATAATTTTACTTTTTTTTTACATTTTGCTTGTTTGGCTTTATTGGC[A/T]GTATTGTTGGAAGCTTTGCTGAACAATGGAAATTCGACAGGAAACARTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102337 Nonsense 76 380 2 8
Genomic Location (Zv9):
Chromosome 1 (position 26845861)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27183006
GRCz11 1 27876720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTACTGCATACTGTGGGAAGTCATCAAATGGATCAAAGCCTGGATCA[C/T]AAACCCAACATGAGGCACCAAAGCAAGACTCAGCAGCTGCAGATTTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link