gadd45ab

Ensembl ID:
ENSDARG00000069991
ZFIN ID:
ZDB-GENE-040704-60
Description:
growth arrest and DNA-damage-inducible, alpha, b [Source:RefSeq peptide;Acc:NP_001002216]
Human Orthologue:
GADD45A
Human Description:
growth arrest and DNA-damage-inducible, alpha [Source:HGNC Symbol;Acc:4095]
Mouse Orthologue:
Gadd45a
Mouse Description:
growth arrest and DNA-damage-inducible 45 alpha Gene [Source:MGI Symbol;Acc:MGI:107799]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45249 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102325 Nonsense 147 156 4 4
Genomic Location (Zv9):
Chromosome 6 (position 20081969)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23838708
GRCz11 6 23938517
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGCAAACTGAATCGATTCTGTAGAGACAGTCGGGGTTTGGACCAGTG[G/A]GTGCCAGTCATCAATCTCCCCGAACGATGAACAGAAGCAAACAATCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link