zgc:110251

Ensembl ID:
ENSDARG00000069966
ZFIN ID:
ZDB-GENE-050522-330
Description:
hypothetical protein LOC553602 [Source:RefSeq peptide;Acc:NP_001018414]
Human Orthologue:
ALOX5
Human Description:
arachidonate 5-lipoxygenase [Source:HGNC Symbol;Acc:435]
Mouse Orthologue:
Alox5
Mouse Description:
arachidonate 5-lipoxygenase Gene [Source:MGI Symbol;Acc:MGI:87999]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17737 Essential Splice Site Available for shipment Available now
sa42462 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa17737
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102257 Essential Splice Site 485 676 11 15
Genomic Location (Zv9):
Chromosome 15 (position 593903)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 634206
GRCz11 15 595009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACTACTATAGAGACGATGGCATGMTGGTCTGGGAGGCTGTGAAAAG[G/A]TAGTTAAACTGCRCWAACATTTACAAATTTCAAACACTGATATTGGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102257 Nonsense 617 676 14 15
Genomic Location (Zv9):
Chromosome 15 (position 591904)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 632207
GRCz11 15 593010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCTGGCACCTGGGAGCACTTTGGTCGCTCAGTCAGTTCCAGGATAAC[G/T]AGGTTAGCTGACTGGTTATTCATAACTAGCCTAGAATACACTTGCTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link