zgc:162936

Ensembl ID:
ENSDARG00000069957
ZFIN ID:
ZDB-GENE-030131-5253
Description:
Zgc:162936 protein [Source:UniProtKB/TrEMBL;Acc:A3KP43]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa744 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa744
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102239 Essential Splice Site None 394 2 3
ENSDART00000106627   None 394 1 2
ENSDART00000127431   None 602 None 3
Genomic Location (Zv9):
Chromosome 15 (position 928891)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 969194
GRCz11 15 929997
KASP Assay ID:
554-0651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTGATGGAGATTTAGTTTGTCTTCATTTTTTTGTTTTCTCTGTTAA[T/G]GATTCTCTTCTTCATGTTGATMGTGTCTAAAAACACAAACTCCTGAAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link