si:dkey-29l6.1

Ensembl ID:
ENSDARG00000069954
ZFIN ID:
ZDB-GENE-090312-185
Description:
Novel protein similar to vertebrate potassium voltage-gated channel, KQT-like subfamily, member 5 (K
Human Orthologue:
KCNQ5
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 5 [Source:HGNC Symbol;Acc:6299]
Mouse Orthologue:
Kcnq5
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 5 Gene [Source:MGI Symbol;Acc:MGI:1924937]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11293 Nonsense Available for shipment Available now
sa9563 Nonsense Available for shipment Available now
sa22313 Nonsense Available for shipment Available now
sa35500 Nonsense Mutation detected in F1 DNA During 2018
sa42212 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102232 Nonsense 100 975 1 15
ENSDART00000139904 Nonsense 100 929 1 13
ENSDART00000146230   None 173 None 3
ENSDART00000102232 Nonsense 100 975 1 15
ENSDART00000139904 Nonsense 100 929 1 13
ENSDART00000146230   None 173 None 3
Genomic Location (Zv9):
Chromosome 13 (position 27844408)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27490068
GRCz11 13 27620518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACGCRCGCTACAGGARGCTCCAGAACTACCTCTACARTGTCCTGGAG[C/T]GACCGCGAGCCTGGGCATTCGTTTACCATGYCTTTGTGTAAGTAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9563
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102232 Nonsense 100 975 1 15
ENSDART00000139904 Nonsense 100 929 1 13
ENSDART00000146230   None 173 None 3
ENSDART00000102232 Nonsense 100 975 1 15
ENSDART00000139904 Nonsense 100 929 1 13
ENSDART00000146230   None 173 None 3
Genomic Location (Zv9):
Chromosome 13 (position 27844408)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27490068
GRCz11 13 27620518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACGCRCGCTACAGGARGCTCCAGAACTACCTCTACARTGTCCTGGAG[C/T]GACCGCGAGCCTGGGCATTCGTTTACCATGYCTTTGTGTAAGTAAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102232 Nonsense 173 975 3 15
ENSDART00000139904 Nonsense 173 929 3 13
ENSDART00000146230   None 173 None 3
Genomic Location (Zv9):
Chromosome 13 (position 27661356)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27307016
GRCz11 13 27437466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCATCTGGTCTGCTGGATGCTGCTGCCGGTACAGGGGATGGCAAGGA[C/T]GACTGCGCTTCGCTAGAAAACCATTCTGTGTGATAGGTAAGATAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102232 Nonsense 874 975 15 15
ENSDART00000139904 Nonsense 828 929 13 13
ENSDART00000146230   None 173 None 3
Genomic Location (Zv9):
Chromosome 13 (position 27603055)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27248715
GRCz11 13 27379165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGATGCTCATGTCTTCCACAGCAGCTGCTTCGCTACAGGTCGAGCGT[G/T]GACTCGGTAAGTCTCTTTCAGCTCAGAACCTCATGCTACCAACTGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102232 Nonsense 959 975 15 15
ENSDART00000139904 Nonsense 913 929 13 13
ENSDART00000146230   None 173 None 3
Genomic Location (Zv9):
Chromosome 13 (position 27602800)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 27248460
GRCz11 13 27378910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGAGCTGCTACGGACAGGGGCCAGCGGGACGTCTCCCAGTCAGGCT[G/T]GACCAAGAGATGTTCTCGAGTCCCATAACTTGCCTCACGTATGCCTCGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link