si:dkey-7m11.2

Ensembl ID:
ENSDARG00000069953
ZFIN ID:
ZDB-GENE-090312-178
Description:
Novel protein similar to H.sapiens KCNQ5, potassium voltage-gated channel, KQT-like subfamily, membe
Human Orthologue:
KCNQ5
Human Description:
potassium voltage-gated channel, KQT-like subfamily, member 5 [Source:HGNC Symbol;Acc:6299]
Mouse Orthologue:
Kcnq5
Mouse Description:
potassium voltage-gated channel, subfamily Q, member 5 Gene [Source:MGI Symbol;Acc:MGI:1924937]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19519 Nonsense Available for shipment Available now
sa39631 Essential Splice Site Mutation detected in F1 DNA During 2018
sa19518 Nonsense Available for shipment Available now
sa39630 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 226 974 4 14
ENSDART00000148069 Nonsense 109 538 3 13
Genomic Location (Zv9):
Chromosome 1 (position 30227346)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30367158
GRCz11 1 31171089
KASP Assay ID:
2259-0715.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTTGCAACGTCTGCTCTGCGAAGCTTAAGATTTCTACAAATCCTG[C/T]GAATGGTACGCATGGACCGCCGCGGAGGAACTTGGAAGCTTCTGGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Essential Splice Site 249 974 4 14
ENSDART00000148069 Essential Splice Site 132 538 3 13
Genomic Location (Zv9):
Chromosome 1 (position 30227273)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30367085
GRCz11 1 31171016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGAGGAACTTGGAAGCTTCTGGGATCTGTAGTTTATGCACACAGCAAGG[T/C]AACTTGATTTTTGACAAATTGTCATCTAAAATTATTTAAAAGGTTGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 331 974 7 14
ENSDART00000148069 Nonsense 214 538 6 13
Genomic Location (Zv9):
Chromosome 1 (position 30222545)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30362357
GRCz11 1 31166288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTGTCCATTTTTCATGATATGGTTCTTTTTCACTTGCAGGGTATTT[T/A]GGGTTCAGGTTTTGCCTTGAAGGTTCAAGAGCAGCACAGACAGAAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085370 Nonsense 681 974 14 14
ENSDART00000148069   None 538 None 13
Genomic Location (Zv9):
Chromosome 1 (position 30192820)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30332632
GRCz11 1 31136563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAGGGCCCTCCAGCTAATATTAGCCCCCAATGAACTCATGAACCTCAAC[C/T]AGAACAACTCCACAACATCTTCCCCAGGACTCAACCCAGCGTCCGCCTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link