zgc:110335

Ensembl ID:
ENSDARG00000069951
ZFIN ID:
ZDB-GENE-050417-327
Description:
eukaryotic translation elongation factor 1 alpha 1 [Source:RefSeq peptide;Acc:NP_001017795]
Human Orthologue:
EEF1A1
Human Description:
eukaryotic translation elongation factor 1 alpha 1 [Source:HGNC Symbol;Acc:3189]
Mouse Orthologue:
Eef1a1
Mouse Description:
eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1096881]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18700 Nonsense Mutation detected in F1 DNA During 2018
sa11028 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075340 Nonsense 69 462 3 8
ENSDART00000137863 Nonsense 69 462 4 9
ENSDART00000075340 Nonsense 69 462 3 8
ENSDART00000137863 Nonsense 69 462 4 9
Genomic Location (Zv9):
Chromosome 1 (position 30173588)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30313400
GRCz11 1 31117331
KASP Assay ID:
2259-0711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCTTTAAGTATGCTTGGGTCCTTGACAAACTGAAAGCTGAGAGAGAG[C/T]GAGGCATCACCATCGATATCTCCCTGTGGAAGTTTGAGACAAGCAAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11028
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075340 Nonsense 69 462 3 8
ENSDART00000137863 Nonsense 69 462 4 9
ENSDART00000075340 Nonsense 69 462 3 8
ENSDART00000137863 Nonsense 69 462 4 9
Genomic Location (Zv9):
Chromosome 1 (position 30173588)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30313400
GRCz11 1 31117331
KASP Assay ID:
2259-0711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTTTAAGTATGCTTGGGTCCTTGACAAACTGAAAGCTGAGAGAGAG[C/T]GAGGCATCACCATCGATATCTCCCTGTGGAAGTTTGAGACAAGCAAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link