zgc:158309

Ensembl ID:
ENSDARG00000069940
ZFIN ID:
ZDB-GENE-061201-42
Description:
phosphatidic acid phosphatase type 2B [Source:RefSeq peptide;Acc:NP_001073447]
Human Orthologue:
PPAP2B
Human Description:
phosphatidic acid phosphatase type 2B [Source:HGNC Symbol;Acc:9229]
Mouse Orthologue:
Ppap2b
Mouse Description:
phosphatidic acid phosphatase type 2B Gene [Source:MGI Symbol;Acc:MGI:1915166]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20132 Nonsense Available for shipment Available now
sa38409 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12356 Essential Splice Site Available for shipment Available now
sa40150 Nonsense Mutation detected in F1 DNA During 2018
sa6915 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40151 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40152 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa20132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Nonsense 80 323 2 6
Genomic Location (Zv9):
Chromosome 3 (position 48562428)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50563568
GRCz11 3 47374208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCTCCATTCCATTCTTCGCCTGTGAGCTCAAAGCGGTGACACCATA[C/A]ATGAGAGGCTTCTTCTGCGGGGATACCAGCATTACCTACCCTTACATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Essential Splice Site 117 323 2 6
ENSDART00000102202 Essential Splice Site 117 323 2 6
Genomic Location (Zv9):
Chromosome 3 (position 48562541)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50563681
GRCz11 3 47374321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGATAGCGTGCTTATAGCCGGGGGCATCATAATCACAGGACTTACGG[T/A]GAGAATATGCACACTTACAAAAATATCACTAGCTGAAATCCCTTCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Essential Splice Site 117 323 2 6
ENSDART00000102202 Essential Splice Site 117 323 2 6
Genomic Location (Zv9):
Chromosome 3 (position 48562541)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50563681
GRCz11 3 47374321
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGATAGCGTGCTTATAGCCGGGGGCATCATAATCACAGGACTTACGG[T/G]GAGAATATGCACACTTACAAAAATATCACYWGCTGAAATCCCTTYAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Nonsense 141 323 3 6
Genomic Location (Zv9):
Chromosome 3 (position 48564929)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50566069
GRCz11 3 47376709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGTACGATTCAGAGATGTGCACTCACGGGCATTTGTACGCAACCTCTA[C/A]GTGTCCTGTCTCTACAAGGAGTTGGGCAGCTTTTTATTTGGCTGCTGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Essential Splice Site 212 323 4 6
Genomic Location (Zv9):
Chromosome 3 (position 48567108)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50568248
GRCz11 3 47378888
KASP Assay ID:
554-4870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATTATGACATTTGGTTAGTAATATTTCCCTTYTGCTCTTCCTAAACA[G/A]AAAATCCTTCTTCTCGGGCCATGCATCTTTCGCCATGTACACCATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Essential Splice Site 231 323 4 6
Genomic Location (Zv9):
Chromosome 3 (position 48567168)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50568308
GRCz11 3 47378948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCGGGCCATGCATCTTTCGCCATGTACACCATGCTTTACCTGGCAG[T/A]GAGTATCTCTGTGTGTGGGCATGTTTACCACAAGCACACTCATACACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102202 Essential Splice Site 290 323 5 6
Genomic Location (Zv9):
Chromosome 3 (position 48572904)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50574044
GRCz11 3 47384684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGTCCTGACCGGCTTCTTGCAGGGAGGACTGACTGCTTACTGGGTGG[T/A]AAGAATCATGTCACCACAAGCTCTCAGCTCTTACTCTTAGGATCCACTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link