wu:fa92h04

Ensembl ID:
ENSDARG00000069933
ZFIN ID:
ZDB-GENE-030131-8638
Human Orthologue:
MAP3K6
Human Description:
mitogen-activated protein kinase kinase kinase 6 [Source:HGNC Symbol;Acc:6858]
Mouse Orthologue:
Map3k6
Mouse Description:
mitogen-activated protein kinase kinase kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1855691]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22907 Nonsense Available for shipment Available now
sa12714 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102183 Nonsense 495 1324 9 28
Genomic Location (Zv9):
Chromosome 16 (position 39580412)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35654535
GRCz11 16 35607410
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAGTGAATCATCCTAAACAAGAAACTGCAGACTTTTGGATGGAGT[T/A]GATGGTACAAGCATGCAAACCTACCGTTTCCACAGCACGATGCCCAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102183 Essential Splice Site 624 1324 13 28
Genomic Location (Zv9):
Chromosome 16 (position 39584799)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35658922
GRCz11 16 35611797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTGGAGGATTCCAGTTCAATGAGGGGAGAGGAAGGAGATTTAGAGG[T/A]GAGCCAAATATTTTATTAGCTTGATTGTTTGTTTAGGTCAGGTCACAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link