zgc:162582

Ensembl ID:
ENSDARG00000069932
ZFIN ID:
ZDB-GENE-070410-82
Description:
hypothetical protein LOC100037329 [Source:RefSeq peptide;Acc:NP_001082953]
Human Orthologue:
SCMH1
Human Description:
sex comb on midleg homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19003]
Mouse Orthologue:
Scmh1
Mouse Description:
sex comb on midleg homolog 1 Gene [Source:MGI Symbol;Acc:MGI:1352762]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39122 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17669 Essential Splice Site Available for shipment Available now
sa11528 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39122
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102181   None 120 None 4
ENSDART00000115339 Essential Splice Site 330 733 7 15
Genomic Location (Zv9):
Chromosome 16 (position 39545565)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35619688
GRCz11 16 35572563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATCTATTAAAATCCCCAAGAAACGAGGTCCCAAACCAGGAAGCAAGG[T/A]AAAAACGATATTGAAAGACATTACAGATTCAAGTATTTCAGTAGTTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102181   None 120 None 4
ENSDART00000115339 Essential Splice Site 430 733 9 15
Genomic Location (Zv9):
Chromosome 16 (position 39542123)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35616246
GRCz11 16 35569121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGATGGACAATGCCACAATTCCCAAAGCYGCCCTACAGGCCCCTACAGG[T/A]ACTACTGCAWGYGTATATTTTCAGGTTTACCCTTGCAAAGAAGTATTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11528
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102181   None 120 None 4
ENSDART00000115339 Nonsense 656 733 14 15
Genomic Location (Zv9):
Chromosome 16 (position 39533122)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 35607245
GRCz11 16 35560120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGACTGCTTTCTAGGTTCAGAGCGCTTTCTGAGCTYCAGGGAAAGCCCA[C/T]GACCCAGTGGACAAGACCCCAACCTATGGACWGTAGAGGATGTTATGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link