ska3

Ensembl ID:
ENSDARG00000069917
ZFIN ID:
ZDB-GENE-030131-2997
Description:
Spindle and kinetochore-associated protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q58EL7]
Human Orthologue:
SKA3
Human Description:
spindle and kinetochore associated complex subunit 3 [Source:HGNC Symbol;Acc:20262]
Mouse Orthologue:
F630043A04Rik
Mouse Description:
RIKEN cDNA F630043A04 gene Gene [Source:MGI Symbol;Acc:MGI:3041235]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17736 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102139 Nonsense 82 495 3 9
ENSDART00000132324 Nonsense 82 294 4 8
ENSDART00000137024 Nonsense 82 495 4 10
ENSDART00000145943 Nonsense 82 275 3 5
Genomic Location (Zv9):
Chromosome 9 (position 22294097)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 21449883
GRCz11 9 21260752
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCCATGAKACAAGCAGTGCTGACCTGAGGAGCTTCATCAGAAGATGTT[T/A]GGTGCTGAAGCAGAGAACCACAGAAGACATTGACAGTCTRAAGAAACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link