
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000069904
- Ensembl ID:
- ENSDARG00000069904
- Human Orthologues:
- COL19A1, COL21A1, COL9A1, COL9A2, COL9A3
- Human Descriptions:
- collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
- collagen, type IX, alpha 2 [Source:HGNC Symbol;Acc:2218]
- collagen, type IX, alpha 3 [Source:HGNC Symbol;Acc:2219]
- collagen, type XIX, alpha 1 [Source:HGNC Symbol;Acc:2196]
- collagen, type XXI, alpha 1 [Source:HGNC Symbol;Acc:17025]
- Mouse Orthologues:
- Col19a1, Col9a1, Col9a2, Col9a3
- Mouse Descriptions:
- collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]
- collagen, type IX, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:88466]
- collagen, type IX, alpha 3 Gene [Source:MGI Symbol;Acc:MGI:894686]
- collagen, type XIX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1095415]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24419 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa25200 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24419
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000030004 | Nonsense | 293 | 606 | 1 | 14 |
- Genomic Location (Zv9):
- Chromosome 23 (position 46278089)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 46163556 GRCz11 23 46114782 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCCAGGCAAGAGTCTCGATGCTGAAAACGAGACCGAGGATCATCATCTT[A/T]AGAAGCCGAGAGGGACTCGATCCACCCCAGATCTGATCTCCATCATCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25200
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000030004 | Nonsense | 466 | 606 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 23 (position 46233562)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 46119029 GRCz11 23 46070255 - KASP Assay ID:
- 554-7890.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGATCATAATCCGCATCTGTTTTCCTCCATTGTAGGGTCCCAAAGGCTA[T/A]CCAGGACCCGCAGGTCTGCCCGGAGAACAGGTGAGTTGATGAAACGCACC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Response to statin therapy: Genome-wide association of lipid-lowering response to statins in combined study populations. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
More OMIM information for COL9A1
- Epiphyseal dysplasia, multiple, 2
- Stickler syndrome, type V
- Intervertebral disc disease, susceptibility to
More OMIM information for COL9A2
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: