zgc:56066

Ensembl ID:
ENSDARG00000069878
ZFIN ID:
ZDB-GENE-040426-879
Description:
hypothetical protein LOC393282 [Source:RefSeq peptide;Acc:NP_956606]
Human Orthologue:
NHP2L1
Human Description:
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:7819]
Mouse Orthologues:
CR974466.2, Gm5616, Nhp2l1
Mouse Descriptions:
NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:893586]
predicted gene 5616 Gene [Source:MGI Symbol;Acc:MGI:3646416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40183 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093031 Essential Splice Site 42 128 2 3
Genomic Location (Zv9):
Chromosome 3 (position 59030617)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 58092292
GRCz11 3 58162816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAGCAGGCAGCCAATTACAAACAGCTGAGGAAAGGGGCCAACGAAGG[T/A]AATTCAGCACTCAATACTCTTTAACGCCAACTTAACCAGCACAAGTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link