zgc:113030

Ensembl ID:
ENSDARG00000069869
ZFIN ID:
ZDB-GENE-050522-528
Description:
hypothetical protein LOC553738 [Source:RefSeq peptide;Acc:NP_001018545]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33338 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080437 Nonsense 201 240 2 2
Genomic Location (Zv9):
Chromosome 3 (position 60480223)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59782682
GRCz11 3 60073783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCATGTCTGCTTTGAGTGTGAGAAGACTTTCGTTACAGCTGATGATT[T/A]GAAACGGCACCAAAGGATTCACACTGGAGAGAAACCGTACATGTGTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link