
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cx55.5
- Ensembl ID:
- ENSDARG00000069830
- ZFIN ID:
- ZDB-GENE-010619-3
- Description:
- gap junction alpha-9 protein [Source:RefSeq peptide;Acc:NP_571887]
- Human Orthologues:
- GJA10, GJA9
- Human Descriptions:
- gap junction protein, alpha 10, 62kDa [Source:HGNC Symbol;Acc:16995]
- gap junction protein, alpha 9, 59kDa [Source:HGNC Symbol;Acc:19155]
- Mouse Orthologue:
- Gja10
- Mouse Description:
- gap junction protein, alpha 10 Gene [Source:MGI Symbol;Acc:MGI:1339969]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa22892 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22892
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101948 | Nonsense | 49 | 498 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 16 (position 35471858)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 33204167 GRCz11 16 33158197 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCGCATGCTGGTGCTTGGTGTGGCAGCGGAGGATGTGTGGAATGATGAA[C/T]AGGCTGACTTTATCTGCAACACCGAGCAGCCTGGTTGCCGCAATGTGTGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: