zgc:173573

Ensembl ID:
ENSDARG00000069796
ZFIN IDs:
ZDB-GENE-050306-3, ZDB-GENE-071004-105, ZDB-GENE-071004-105
Description:
Zgc:173573 [Source:UniProtKB/TrEMBL;Acc:A9JRM8]
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2119 Nonsense F2 line generated During 2018
sa38415 Nonsense Mutation detected in F1 DNA During 2018
sa11168 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2119
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719   None 305 None 3
ENSDART00000074170   None 309 None 4
ENSDART00000112516   None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
ENSDART00000058719   None 305 None 3
ENSDART00000074170   None 309 None 4
ENSDART00000112516   None 305 None 3
ENSDART00000125238 Nonsense 215 1014 1 5
Genomic Location (Zv9):
Chromosome 3 (position 62970756)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62071861
GRCz11 3 62308491
KASP Assay ID:
554-3247.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACCATTCACATGCACTCATTGTGGGAAGAGTTTCGGCCAATCATCA[C/T]AATTTAATAATCACATGAGGATCCACACTGGAGAGAAACCRTTCACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719   None 305 None 3
ENSDART00000074170   None 309 None 4
ENSDART00000112516   None 305 None 3
ENSDART00000125238 Nonsense 311 1014 1 5
Genomic Location (Zv9):
Chromosome 3 (position 62971044)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62072149
GRCz11 3 62308779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACTACTCATCAACCCTTAATCAACACATGAGGATCCACACTGGAGAG[A/T]AACCATTCACATGCACTCAGTGTGGGAGGGGTTTCAGCCAAATGTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11168
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058719   None 305 None 3
ENSDART00000074170   None 309 None 4
ENSDART00000112516   None 305 None 3
ENSDART00000125238 Nonsense 538 1014 2 5
Genomic Location (Zv9):
Chromosome 3 (position 62976815)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 62077920
GRCz11 3 62314550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCACACCTTAATGAYCACATGAAGATCCACACTGGTGTAAAAGAGTA[T/A]ATGTGCTTTGAGTGTGACAAGACTTTTATTAAAGCTGGAGAATTGAAAYA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link