zgc:172158

Ensembl ID:
ENSDARG00000069775
ZFIN ID:
ZDB-GENE-080220-36
Description:
hypothetical protein LOC100005140 [Source:RefSeq peptide;Acc:NP_001107129]
Human Orthologue:
FBXO40
Human Description:
F-box protein 40 [Source:HGNC Symbol;Acc:29816]
Mouse Orthologue:
Fbxo40
Mouse Description:
F-box protein 40 Gene [Source:MGI Symbol;Acc:MGI:2443753]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10694 Nonsense Available for shipment Available now
sa12370 Nonsense Available for shipment Available now
sa32347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10694
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 273 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843789)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22692202
GRCz11 21 22728807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTCTTACAGGAAGAGCCAGAACAAAATATCAATCCTACCGATGTTCCT[C/T]AATACAACGCTTATGAAACGGATGATGAGAAATTCCTAATCGCTTCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 403 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843399)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22691812
GRCz11 21 22728417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATAATGGACACAGGAACTCAGACGTATGATTTCTACACGRCACCCTTC[A/T]AAGCAGAGGCGTCGCTGGCTGATATCACTGCTGACCGGCCGTTAAAAYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101797 Nonsense 470 670 2 3
Genomic Location (Zv9):
Chromosome 21 (position 21843196)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22691609
GRCz11 21 22728214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACTACAAAAACACCCATGCTGACATCCAGAGCTGCATCAGTGGATG[G/A]TTTGAACAGCGATGTCCTCTTTCTTACCTTGGCTGCACTTTCATTCAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link