
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:64103
- Ensembl ID:
- ENSDARG00000069774
- ZFIN ID:
- ZDB-GENE-040426-1368
- Description:
- flotillin 2 [Source:RefSeq peptide;Acc:NP_956933]
- Human Orthologue:
- FLOT2
- Human Description:
- flotillin 2 [Source:HGNC Symbol;Acc:3758]
- Mouse Orthologue:
- Flot2
- Mouse Description:
- flotillin 2 Gene [Source:MGI Symbol;Acc:MGI:103309]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15634 | Essential Splice Site | Available for shipment | Available now |
sa35840 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15634
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101157 | Essential Splice Site | 116 | 177 | 4 | 7 |
ENSDART00000101789 | Essential Splice Site | 116 | 428 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 15414675)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 16459638 GRCz11 15 16395660 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAAGCTGTGGTTCTGCAAACCCTTGAGGGACATTTGCGTTCAATCTTAGG[T/C]TAATACATCACCAAGAATTACAATAACCTYATTAAAACTAACASTTCCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35840
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101157 | None | 177 | None | 7 | |
ENSDART00000101789 | Essential Splice Site | 233 | 428 | 7 | 11 |
- Genomic Location (Zv9):
- Chromosome 15 (position 15417574)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 16462537 GRCz11 15 16398559 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGCTTGAGCTGCAAAAAGCCGCTTTTAACCAAGAAGTAAACACTAAGG[T/G]CAGATTCAATGTAATTCCAGTGCCTGGCCATCTTTTTTAGTCATGGTCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: