zgc:64103

Ensembl ID:
ENSDARG00000069774
ZFIN ID:
ZDB-GENE-040426-1368
Description:
flotillin 2 [Source:RefSeq peptide;Acc:NP_956933]
Human Orthologue:
FLOT2
Human Description:
flotillin 2 [Source:HGNC Symbol;Acc:3758]
Mouse Orthologue:
Flot2
Mouse Description:
flotillin 2 Gene [Source:MGI Symbol;Acc:MGI:103309]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15634 Essential Splice Site Available for shipment Available now
sa35840 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101157 Essential Splice Site 116 177 4 7
ENSDART00000101789 Essential Splice Site 116 428 4 11
Genomic Location (Zv9):
Chromosome 15 (position 15414675)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16459638
GRCz11 15 16395660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGCTGTGGTTCTGCAAACCCTTGAGGGACATTTGCGTTCAATCTTAGG[T/C]TAATACATCACCAAGAATTACAATAACCTYATTAAAACTAACASTTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101157   None 177 None 7
ENSDART00000101789 Essential Splice Site 233 428 7 11
Genomic Location (Zv9):
Chromosome 15 (position 15417574)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16462537
GRCz11 15 16398559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCTTGAGCTGCAAAAAGCCGCTTTTAACCAAGAAGTAAACACTAAGG[T/G]CAGATTCAATGTAATTCCAGTGCCTGGCCATCTTTTTTAGTCATGGTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link