si:dkeyp-6a12.1

Ensembl ID:
ENSDARG00000069766
ZFIN ID:
ZDB-GENE-091204-251
Human Orthologue:
CALN1
Human Description:
calneuron 1 [Source:HGNC Symbol;Acc:13248]
Mouse Orthologue:
Caln1
Mouse Description:
calneuron 1 Gene [Source:MGI Symbol;Acc:MGI:2155987]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa709 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa709
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101780 Essential Splice Site 39 218 1 5
ENSDART00000141149 Essential Splice Site 39 218 2 6
Genomic Location (Zv9):
Chromosome 21 (position 25341584)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25911402
GRCz11 21 25948097
KASP Assay ID:
554-0617.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACCAGCGAAGAGCAGCTTGCCAACATCTCTACAGAGGAACTCGGCGG[T/G]GAGTCTGGTCTGTGTGTGTGTAAATGACTGATGTCTGTCTCAGTGTCAAT
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link