si:dkey-246f6.1

Ensembl ID:
ENSDARG00000069765
ZFIN ID:
ZDB-GENE-100921-2
Human Orthologue:
SYNGAP1
Human Description:
synaptic Ras GTPase activating protein 1 [Source:HGNC Symbol;Acc:11497]
Mouse Orthologue:
Syngap1
Mouse Description:
synaptic Ras GTPase activating protein 1 homolog (rat) Gene [Source:MGI Symbol;Acc:MGI:3039785]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18055 Nonsense Available for shipment Available now
sa36251 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30692 Nonsense Mutation detected in F1 DNA During 2018
sa39127 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa18055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093365 Nonsense 297 1246 7 19
ENSDART00000143867 Nonsense 250 1168 7 18
Genomic Location (Zv9):
Chromosome 16 (position 48691199)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45660420
GRCz11 16 45627136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCAGCATCACTGGCCGTCAGTTTGTGGAGCAATGGTACCCCGTCATT[C/T]AGCCCAGTGTTCTRGCCAARGGTGGCGGCGTYGGAGGAGGGAAGATCATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093365 Essential Splice Site 762 1246 13 19
ENSDART00000143867 Essential Splice Site 715 1168 13 18
Genomic Location (Zv9):
Chromosome 16 (position 48704343)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45673564
GRCz11 16 45640280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGCGTACTGTACTAGCAGTTCAGATATTACTGATCCAGACCCAAAGG[T/C]AAGTCCTTCTGCTGAAAAAAAACCCAGCCCATGTCGTTTAGATTTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093365 Nonsense 779 1246 14 19
ENSDART00000143867 Nonsense 732 1168 14 18
Genomic Location (Zv9):
Chromosome 16 (position 48707798)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45677019
GRCz11 16 45643735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTCGATTGCTGGCCTCGGCAGCTACGGTGGGCTCGCAGGCTTGGGT[G/T]GAGGCCTCGGAGGTCAGCTGCGAGCCGGAGGACGTATGTCGGCCGGATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39127
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093365 Nonsense 1195 1246 17 19
ENSDART00000143867 Nonsense 1148 1168 17 18
Genomic Location (Zv9):
Chromosome 16 (position 48724250)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 45693471
GRCz11 16 45660187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGCTGCAGTATCAGAGCCGACTGGACGACAGCGAGAGGAGACTCCGA[C/T]AGCAGCAGATGGAGAAAGACAACCAAATTAAAGGAATTATTGACAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link