
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-246f6.1
- Ensembl ID:
- ENSDARG00000069765
- ZFIN ID:
- ZDB-GENE-100921-2
- Human Orthologue:
- SYNGAP1
- Human Description:
- synaptic Ras GTPase activating protein 1 [Source:HGNC Symbol;Acc:11497]
- Mouse Orthologue:
- Syngap1
- Mouse Description:
- synaptic Ras GTPase activating protein 1 homolog (rat) Gene [Source:MGI Symbol;Acc:MGI:3039785]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa18055 | Nonsense | Available for shipment | Available now |
sa36251 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa30692 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39127 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa18055
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093365 | Nonsense | 297 | 1246 | 7 | 19 |
ENSDART00000143867 | Nonsense | 250 | 1168 | 7 | 18 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48691199)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45660420 GRCz11 16 45627136 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCCAGCATCACTGGCCGTCAGTTTGTGGAGCAATGGTACCCCGTCATT[C/T]AGCCCAGTGTTCTRGCCAARGGTGGCGGCGTYGGAGGAGGGAAGATCATY
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36251
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093365 | Essential Splice Site | 762 | 1246 | 13 | 19 |
ENSDART00000143867 | Essential Splice Site | 715 | 1168 | 13 | 18 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48704343)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45673564 GRCz11 16 45640280 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAGCGTACTGTACTAGCAGTTCAGATATTACTGATCCAGACCCAAAGG[T/C]AAGTCCTTCTGCTGAAAAAAAACCCAGCCCATGTCGTTTAGATTTCTCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30692
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093365 | Nonsense | 779 | 1246 | 14 | 19 |
ENSDART00000143867 | Nonsense | 732 | 1168 | 14 | 18 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48707798)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45677019 GRCz11 16 45643735 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGCCTCGATTGCTGGCCTCGGCAGCTACGGTGGGCTCGCAGGCTTGGGT[G/T]GAGGCCTCGGAGGTCAGCTGCGAGCCGGAGGACGTATGTCGGCCGGATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39127
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093365 | Nonsense | 1195 | 1246 | 17 | 19 |
ENSDART00000143867 | Nonsense | 1148 | 1168 | 17 | 18 |
- Genomic Location (Zv9):
- Chromosome 16 (position 48724250)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 45693471 GRCz11 16 45660187 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCTGCTGCAGTATCAGAGCCGACTGGACGACAGCGAGAGGAGACTCCGA[C/T]AGCAGCAGATGGAGAAAGACAACCAAATTAAAGGAATTATTGACAGGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: