zgc:162984

Ensembl ID:
ENSDARG00000069729
ZFIN IDs:
ZDB-GENE-040724-115, ZDB-GENE-040724-115, ZDB-GENE-070410-121
Description:
DNA-3-methyladenine glycosylase [Source:RefSeq peptide;Acc:NP_001076319]
Human Orthologue:
MPG
Human Description:
N-methylpurine-DNA glycosylase [Source:HGNC Symbol;Acc:7211]
Mouse Orthologue:
Mpg
Mouse Description:
N-methylpurine-DNA glycosylase Gene [Source:MGI Symbol;Acc:MGI:97073]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33327 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33327
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101697 Essential Splice Site 78 282 1 3
ENSDART00000132587 Essential Splice Site 89 293 1 3
Genomic Location (Zv9):
Chromosome 3 (position 55883882)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 54777608
GRCz11 3 55032210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTCAATCAGCCCTGCGTCGAGCTGGCCAAGGCTTTTCTCGGCAAGG[T/C]AATATGATTAACTTAATTTTAGAAAATCATTTCATTGACTTATGAAAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link