si:dkey-27f16.4

Ensembl ID:
ENSDARG00000069710
ZFIN ID:
ZDB-GENE-090313-295
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A4R8]
Human Orthologue:
C6orf27
Human Description:
chromosome 6 open reading frame 27 [Source:HGNC Symbol;Acc:13939]
Mouse Orthologue:
D17H6S56E-3
Mouse Description:
DNA segment, Chr 17, human D6S56E 3 Gene [Source:MGI Symbol;Acc:MGI:1306798]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15280 Nonsense Available for shipment Available now
sa18346 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101664 Nonsense 520 990 10 15
ENSDART00000138992   None 466 None 10
ENSDART00000146119   None 88 None 6

The following transcripts of ENSDARG00000069710 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40716780)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39606189
GRCz11 1 40324262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAGGYGGTGAGAAGTCCAGCTATTGCAGAAAACTTTTCTWTTGTGT[T/A]GGATTCCTCTCTGTYTAATGTAACTGTGTACATCACAGGAGACTCTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101664 Essential Splice Site 624 990 12 15
ENSDART00000138992   None 466 None 10
ENSDART00000146119   None 88 None 6

The following transcripts of ENSDARG00000069710 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 40717704)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 39607113
GRCz11 1 40325186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGTCACAGAGTAGTGACTTTACACCAAAAGCCAATCGTCCTTTCATTG[G/A]TATGATATCGTCTTCAAATTGATATTTCTTGATTATTAATAKACATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link