
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
lgi2b
- Ensembl ID:
- ENSDARG00000069701
- ZFIN ID:
- ZDB-GENE-060217-3
- Description:
- leucine-rich repeat LGI family, member 2b [Source:RefSeq peptide;Acc:NP_001034731]
- Human Orthologue:
- LGI2
- Human Description:
- leucine-rich repeat LGI family, member 2 [Source:HGNC Symbol;Acc:18710]
- Mouse Orthologue:
- Lgi2
- Mouse Description:
- leucine-rich repeat LGI family, member 2 Gene [Source:MGI Symbol;Acc:MGI:2180196]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39651 | Splice Site, Nonsense | Mutation detected in F1 DNA | During 2018 |
sa13065 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39651
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101623 | Splice Site, Nonsense | 120 | 552 | 3 | 8 |
ENSDART00000113109 | Splice Site, Nonsense | 154 | 586 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 1 (position 40416885)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 39306294 GRCz11 1 40024367 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTCTGAAATAAAGGAGGATGCATTCTCAGGGCTTCCTCATCTGGAGTA[T/A]TTGTAAGTATATGGGCAGCTTTACTCAACTCATGAGCAGAAATATCACCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13065
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101623 | Essential Splice Site | 225 | 552 | 6 | 8 |
ENSDART00000113109 | Essential Splice Site | 259 | 586 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome 1 (position 40420171)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 39309580 GRCz11 1 40027653 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTCCTATTAAAGGATGTCCCAGAAAAACACAGCAAGTGTGTCTCCACAG[G/A]TAACTATTTCKGTTCMTCCGATATCTCTGATTAGTTTTAGTTGAATCTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: