
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
col7a1l
- Ensembl ID:
- ENSDARG00000069692
- ZFIN ID:
- ZDB-GENE-030131-9861
- Description:
- Novel protein similar to vertebrate collagen family [Source:UniProtKB/TrEMBL;Acc:Q1LYN6]
- Human Orthologues:
- COL24A1, COL27A1
- Human Descriptions:
- collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]
- collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
- Mouse Orthologues:
- Col24a1, Col27a1
- Mouse Descriptions:
- collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]
- collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6935 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6935
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101592 | None | 589 | None | 14 | |
ENSDART00000141566 | Essential Splice Site | 1067 | 1722 | 22 | 64 |
- Genomic Location (Zv9):
- Chromosome 4 (position 14987750)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 15923603 GRCz11 4 15922358 - KASP Assay ID:
- 554-4626.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACCCAGAAGCTCTTGCTAAACCAGAAGGACCTTGTCCGCTTAAYTGCAAG[G/A]TAAATGCTTTCTCTGACAAATGTTATCTCGATGTTACTGTATTTTTTCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
- Tourette syndrome: Genome-wide association study of Tourette's syndrome. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: