zgc:100984

Ensembl ID:
ENSDARG00000069677
ZFIN ID:
ZDB-GENE-040801-129
Description:
nicolin 1 [Source:RefSeq peptide;Acc:NP_001003610]
Human Orthologue:
NICN1
Human Description:
nicolin 1 [Source:HGNC Symbol;Acc:18317]
Mouse Orthologue:
Nicn1
Mouse Description:
nicolin 1 Gene [Source:MGI Symbol;Acc:MGI:1913507]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37560 Nonsense Mutation detected in F1 DNA During 2018
sa32412 Essential Splice Site Available for shipment Available now
sa25183 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101580 Nonsense 55 209 3 7
Genomic Location (Zv9):
Chromosome 22 (position 36244779)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33410027
GRCz11 22 33364504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCTGTCTAGATTCAGGAAATTTCCTTCAAGAACTTCTACACGGCTTA[T/A]CTAACAGTGCGTTTGCAGAGGAGGCATGGCTCGACTGCATCTAAGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32412
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101580 Essential Splice Site 100 209 3 7
Genomic Location (Zv9):
Chromosome 22 (position 36244915)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33410163
GRCz11 22 33364640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACGCCGAGGCTGGGTCACATGACTATTTCTCCATCTATAGACAACAG[G/A]TAAGACAAGGTAATCAAGAGAGATCGCAAAACCTGGCGAAAGATCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101580 Nonsense 115 209 4 7
Genomic Location (Zv9):
Chromosome 22 (position 36251674)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 33416922
GRCz11 22 33371399
KASP Assay ID:
554-7871.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAGATGTCGACGGAGCCTGATAATGTGACGACAGTGAGACTCATCT[T/A]GCGACAGCCTTCCTCTGAATGGCTCAGCTTCAGCATCGAGGAGATCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link