zgc:154110

Ensembl ID:
ENSDARG00000069672
ZFIN ID:
ZDB-GENE-060929-894
Description:
JmjC domain-containing protein C2orf60 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q08BV2]
Human Orthologues:
C2orf60, JMJD7
Human Descriptions:
chromosome 2 open reading frame 60 [Source:HGNC Symbol;Acc:26754]
jumonji domain containing 7 [Source:HGNC Symbol;Acc:34397]
Mouse Orthologue:
1110034B05Rik
Mouse Description:
RIKEN cDNA 1110034B05 gene Gene [Source:MGI Symbol;Acc:MGI:1915986]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13117 Nonsense Available for shipment Available now
sa17249 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101571 Nonsense 106 326 4 8

The following transcripts of ENSDARG00000069672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 25152297)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24308083
GRCz11 9 24118952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTGAGTGATTAACTAGGATCTTGTTGTTTCCACCAGGATGAAAGTTA[T/A]TATTTGCGCTCACTTGGAGAAGATGCCCGCAAGGTAGTCTGAAGGACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17249
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101571 Nonsense 199 326 7 8

The following transcripts of ENSDARG00000069672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 25150752)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24306538
GRCz11 9 24117407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGATGAAACAGTAATTGTGATGTTTTTAGGGGACAAGTCTGAAGTTT[T/A]GGACATCGACAGTCCAGATCTGCAGCTTTATCCAGAGTTTGTGAAGGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link