zgc:123096

Ensembl ID:
ENSDARG00000069671
ZFIN ID:
ZDB-GENE-050506-22
Description:
hypothetical protein LOC552941 [Source:RefSeq peptide;Acc:NP_001032303]
Human Orthologue:
C2orf47
Human Description:
chromosome 2 open reading frame 47 [Source:HGNC Symbol;Acc:26198]
Mouse Orthologue:
9430016H08Rik
Mouse Description:
RIKEN cDNA 9430016H08 gene Gene [Source:MGI Symbol;Acc:MGI:1915365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11920 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101565 Essential Splice Site 123 243 None 5

The following transcripts of ENSDARG00000069671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 25155909)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24311695
GRCz11 9 24122564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCTCWGTGTCAGTTTGAAGCTCTTGAAGGATTMGTAGCTAAAGATG[T/A]AAGTACATGAAAATACTGAACATATGTTRATATCAGGGTTATTTGAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link