zgc:56085

Ensembl ID:
ENSDARG00000069615
ZFIN ID:
ZDB-GENE-030131-5717
Description:
hypothetical protein LOC327506 [Source:RefSeq peptide;Acc:NP_956110]
Human Orthologue:
CKMT2
Human Description:
creatine kinase, mitochondrial 2 (sarcomeric) [Source:HGNC Symbol;Acc:1996]
Mouse Orthologue:
Ckmt2
Mouse Description:
creatine kinase, mitochondrial 2 Gene [Source:MGI Symbol;Acc:MGI:1923972]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31761 Essential Splice Site Available for shipment Available now
sa38771 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101449 Essential Splice Site 222 417 4 9
Genomic Location (Zv9):
Chromosome 10 (position 3172025)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3065961
GRCz11 10 3124765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAGCCTGACTGAAATGACTGACCATGAGCAGCAGAGACTCATTGAT[G/A]TGAGTTGCTTCAAAGTGACAGAGCTCTTGGCTAAAGAAACATTCCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101449 Essential Splice Site 379 417 8 9
Genomic Location (Zv9):
Chromosome 10 (position 3169058)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3062994
GRCz11 10 3128678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCGATACCTTCGACATCTCAAACCTTGACCGCCTGGGCAAATCCGAG[G/A]TGGGTCATTCAAAGCTAGTGGGCTAACTATACAGAGAGTTACATTTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link