zgc:162331

Ensembl ID:
ENSDARG00000069607
ZFIN ID:
ZDB-GENE-070410-75
Description:
hypothetical protein LOC793007 [Source:RefSeq peptide;Acc:NP_001077328]
Human Orthologue:
SUSD3
Human Description:
sushi domain containing 3 [Source:HGNC Symbol;Acc:28391]
Mouse Orthologue:
Susd3
Mouse Description:
sushi domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1913579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15568 Essential Splice Site Available for shipment Available now
sa25272 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039313 Essential Splice Site 125 313 2 5
Genomic Location (Zv9):
Chromosome 4 (position 4659578)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4777759
GRCz11 4 4786329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGYGCAGCGGCAATGCTCAGTGGAGCAAYTACCCACCCGACTGCGAGGG[T/A]CTGTGCTCATCATTTCTGAAATAAAGAGATATACAAATAAGAAATCCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039313 Nonsense 183 313 4 5
Genomic Location (Zv9):
Chromosome 4 (position 4658086)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4776267
GRCz11 4 4784837
KASP Assay ID:
554-7483.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAAAGGTTAATTAATTTGTTTGATCTTTCAGGACGAGAGACAAGCGC[A/T]AATCATCCTGGAGGACTGAGTGCTGGCTGGAGCGCGAGGAAGGAGACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link