zgc:110759

Ensembl ID:
ENSDARG00000069589
ZFIN IDs:
ZDB-GENE-050306-17, ZDB-GENE-050306-17
Description:
transmembrane protein 222 [Source:RefSeq peptide;Acc:NP_001013334]
Human Orthologue:
TMEM222
Human Description:
transmembrane protein 222 [Source:HGNC Symbol;Acc:25363]
Mouse Orthologue:
Tmem222
Mouse Description:
transmembrane protein 222 Gene [Source:MGI Symbol;Acc:MGI:1098568]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12278 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078887 Essential Splice Site 146 174 5 6
ENSDART00000101402 Essential Splice Site 146 174 5 8
Genomic Location (Zv9):
Chromosome 16 (position 58462657)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 55230513
GRCz11 16 54938538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATGGCTAACCTGTGCCTGCGCTTCCTCATCCACAGCAAACACGWCAG[G/A]TCAGAGACAGTACACAAGCCATCAAACACATGCTAACGTYGACCCTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link