zgc:153151

Ensembl ID:
ENSDARG00000069563
ZFIN ID:
ZDB-GENE-060825-103
Description:
hypothetical protein LOC751646 [Source:RefSeq peptide;Acc:NP_001038830]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20923 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20923
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101353 Nonsense 256 398 5 6
ENSDART00000131053 Nonsense 263 471 5 9
ENSDART00000135653   None 188 None 4
ENSDART00000138450 Nonsense 263 405 5 6
ENSDART00000141389   None 246 None 6
Genomic Location (Zv9):
Chromosome 7 (position 25344350)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23906102
GRCz11 7 24177259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGACTCCATGTGGACACAGCTTCTGTAAGGCCTGCCTCAAGGAATGCT[G/A]GGAAATCAGTCATGACAGCAGATGTCCATGCTGTAAAGAAAGCTTCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link