
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153151
- Ensembl ID:
- ENSDARG00000069563
- ZFIN ID:
- ZDB-GENE-060825-103
- Description:
- hypothetical protein LOC751646 [Source:RefSeq peptide;Acc:NP_001038830]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa20923 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa20923
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101353 | Nonsense | 256 | 398 | 5 | 6 |
ENSDART00000131053 | Nonsense | 263 | 471 | 5 | 9 |
ENSDART00000135653 | None | 188 | None | 4 | |
ENSDART00000138450 | Nonsense | 263 | 405 | 5 | 6 |
ENSDART00000141389 | None | 246 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 7 (position 25344350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 23906102 GRCz11 7 24177259 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGGACTCCATGTGGACACAGCTTCTGTAAGGCCTGCCTCAAGGAATGCT[G/A]GGAAATCAGTCATGACAGCAGATGTCCATGCTGTAAAGAAAGCTTCACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: