atg12

Ensembl ID:
ENSDARG00000069545
ZFIN ID:
ZDB-GENE-071205-7
Description:
Atg12 protein [Source:UniProtKB/TrEMBL;Acc:A8KBB4]
Human Orthologue:
ATG12
Human Description:
ATG12 autophagy related 12 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:588]
Mouse Orthologue:
Atg12
Mouse Description:
autophagy-related 12 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914776]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42684 Nonsense Mutation detected in F1 DNA During 2018
sa31002 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101304 Nonsense 79 120 2 4
ENSDART00000136005 Nonsense 32 73 2 4
ENSDART00000101304 Nonsense 79 120 2 4
ENSDART00000136005 Nonsense 32 73 2 4
Genomic Location (Zv9):
Chromosome 16 (position 15637037)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13995496
GRCz11 16 13885616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACTCGCCCAGTTCATCTCACGCTTCCTCAAGCTGGAGCCCAGCGAA[C/T]AGTTGGTAAGTTGTTTCATTAAAGAGTAGTGGAAAGACCACAGAAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101304 Nonsense 79 120 2 4
ENSDART00000136005 Nonsense 32 73 2 4
ENSDART00000101304 Nonsense 79 120 2 4
ENSDART00000136005 Nonsense 32 73 2 4
Genomic Location (Zv9):
Chromosome 16 (position 15637037)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13995496
GRCz11 16 13885616
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCACTCGCCCAGTTCATCTCACGCTTCCTCAAGCTGGAGCCCAGCGAA[C/T]AGTTGGTAAGTTGTTTCATTAAAGAGTAGTGGAAAGACCACAGAAAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link