zgc:158795

Ensembl ID:
ENSDARG00000069543
ZFIN ID:
ZDB-GENE-070112-172
Description:
galactose-1-phosphate uridylyltransferase [Source:RefSeq peptide;Acc:NP_001074081]
Human Orthologue:
GALT
Human Description:
galactose-1-phosphate uridylyltransferase [Source:HGNC Symbol;Acc:4135]
Mouse Orthologue:
Galt
Mouse Description:
galactose-1-phosphate uridyl transferase Gene [Source:MGI Symbol;Acc:MGI:95638]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21683 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101298   None 239 None 7
ENSDART00000131087 Essential Splice Site 259 369 None 12
ENSDART00000138161 Essential Splice Site 259 364 None 11

The following transcripts of ENSDARG00000069543 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 14301613)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 14379704
GRCz11 10 14337823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACGACATGTCCTGCGTCTTCCTGACCTCACAACCCAGGAGAGAGACAG[T/C]AAGGCTGTTTACATTATATTTGCCAAATTATGTTGCTGCATATGTTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link