
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158795
- Ensembl ID:
- ENSDARG00000069543
- ZFIN ID:
- ZDB-GENE-070112-172
- Description:
- galactose-1-phosphate uridylyltransferase [Source:RefSeq peptide;Acc:NP_001074081]
- Human Orthologue:
- GALT
- Human Description:
- galactose-1-phosphate uridylyltransferase [Source:HGNC Symbol;Acc:4135]
- Mouse Orthologue:
- Galt
- Mouse Description:
- galactose-1-phosphate uridyl transferase Gene [Source:MGI Symbol;Acc:MGI:95638]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21683 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa21683
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101298 | None | 239 | None | 7 | |
ENSDART00000131087 | Essential Splice Site | 259 | 369 | None | 12 |
ENSDART00000138161 | Essential Splice Site | 259 | 364 | None | 11 |
The following transcripts of ENSDARG00000069543 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 10 (position 14301613)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 14379704 GRCz11 10 14337823 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGACGACATGTCCTGCGTCTTCCTGACCTCACAACCCAGGAGAGAGACAG[T/C]AAGGCTGTTTACATTATATTTGCCAAATTATGTTGCTGCATATGTTAAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: