si:dkey-8e10.2

Ensembl ID:
ENSDARG00000069542
ZFIN ID:
ZDB-GENE-081104-441
Description:
Novel protein similar to vertebrate deleted in malignant brain tumors 1 (DMBT1) [Source:UniProtKB/Tr
Human Orthologue:
CD6
Human Description:
CD6 molecule [Source:HGNC Symbol;Acc:1691]
Mouse Orthologue:
Cd6
Mouse Description:
CD6 antigen Gene [Source:MGI Symbol;Acc:MGI:103566]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31630 Nonsense Available for shipment Available now
sa41130 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14189 Essential Splice Site, Splice Site Available for shipment Available now
sa34314 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101300 Nonsense 164 560 3 8
ENSDART00000132894 Nonsense 154 917 3 11
Genomic Location (Zv9):
Chromosome 8 (position 10549346)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9965928
GRCz11 8 10004513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAAAGCTGACATGGTATGCAAGGAGCTTGGTTGTGGGGATCATTATTA[T/G]ATTCCCAAAGCTGGAATATTTAAAACAGAACAGATCAAAAAAAATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101300 Essential Splice Site 207 560 None 8
ENSDART00000132894 Essential Splice Site 201 917 None 11
Genomic Location (Zv9):
Chromosome 8 (position 10549487)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9966069
GRCz11 8 10004654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCCGGCAGCAGACTGCAAGGATCGAGCCAATGTCATCTGCAGCAG[T/A]AAGTGAAGTCTATACTATTATGTTTACTTGTACATTATTCTGATTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101300 Essential Splice Site 207 560 5 8
ENSDART00000132894 Splice Site None 917 None 11
Genomic Location (Zv9):
Chromosome 8 (position 10551120)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9967702
GRCz11 8 10006287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAATAAAAYGTATAAAGCATGTAGAAATAAAAATGAAATTTTCTGCA[T/C]TTACAGACAAWGTCCGGCTTGGCAACTTTACGTCAAAGTGTTTTGGAGAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101300 Nonsense 296 560 5 8
ENSDART00000132894 Nonsense 353 917 5 11
Genomic Location (Zv9):
Chromosome 8 (position 10551387)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 9967969
GRCz11 8 10006554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAAGGTGATGAGGAGTCACTTTGGCATTGCCTGGCAAAGCATGAGCAT[C/T]GATCACATCGATGCGACACAACTAAAGTTACATGTTCAGGTAACTGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link