si:dkey-30c15.2

Ensembl ID:
ENSDARG00000069540
ZFIN ID:
ZDB-GENE-060503-543
Description:
hypothetical protein LOC558938 [Source:RefSeq peptide;Acc:NP_001103851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31020 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101296 Nonsense 80 355 4 12
ENSDART00000133541 Nonsense 98 256 4 9
Genomic Location (Zv9):
Chromosome 18 (position 6995521)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7573211
GRCz11 18 7532146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTTGTTTTGATGGGCACTGCCATTCCTAATTTGCCTTATGAATTGTG[G/A]CCACTCAGTGAAAAGCTGTGCAACATCGGACTGCCGTTATCTTTGGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link