zgc:153981

Ensembl ID:
ENSDARG00000069529
ZFIN ID:
ZDB-GENE-061103-367
Description:
muscle-restricted dual specificity phosphatase [Source:RefSeq peptide;Acc:NP_001071077]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9957 Essential Splice Site Available for shipment Available now
sa19060 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
Genomic Location (Zv9):
Chromosome 13 (position 25060619)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24706279
GRCz11 13 24836729
KASP Assay ID:
2260-6418.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19060
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
ENSDART00000101274 Essential Splice Site 115 184 3 3
ENSDART00000110344 Essential Splice Site 285 348 9 9
Genomic Location (Zv9):
Chromosome 13 (position 25060619)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24706279
GRCz11 13 24836729
KASP Assay ID:
2260-6418.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGTTGCTGATCTCTATTGGTAATTACAGTCTGTGTCTTTTATGTGTA[G/A]GAAAGGTGCTTGTTCACTGCATCATGGGAATGAGTCGATCTGCAACTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link