
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
vps29
- Ensembl ID:
- ENSDARG00000069521
- ZFIN ID:
- ZDB-GENE-030131-8764
- Description:
- Vacuolar protein sorting-associated protein 29 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV68]
- Human Orthologue:
- VPS29
- Human Description:
- vacuolar protein sorting 29 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14340]
- Mouse Orthologue:
- Vps29
- Mouse Description:
- vacuolar protein sorting 29 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1928344]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23895 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23895
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101246 | Nonsense | 46 | 182 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 21 (position 15519744)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 16971523 GRCz11 21 17008159 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGATTCAGCACATCCTATGCACAGGAAACCTCTGTACGAAGGAGAGCTA[C/A]GACTACCTGAAAACACTCGCCGGAGACGTCCACATCGTCAGAGGAGACTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: