vps29

Ensembl ID:
ENSDARG00000069521
ZFIN ID:
ZDB-GENE-030131-8764
Description:
Vacuolar protein sorting-associated protein 29 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZV68]
Human Orthologue:
VPS29
Human Description:
vacuolar protein sorting 29 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:14340]
Mouse Orthologue:
Vps29
Mouse Description:
vacuolar protein sorting 29 (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1928344]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23895 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101246 Nonsense 46 182 2 4
Genomic Location (Zv9):
Chromosome 21 (position 15519744)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16971523
GRCz11 21 17008159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTCAGCACATCCTATGCACAGGAAACCTCTGTACGAAGGAGAGCTA[C/A]GACTACCTGAAAACACTCGCCGGAGACGTCCACATCGTCAGAGGAGACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link