aqp3b

Ensembl ID:
ENSDARG00000069518
ZFIN ID:
ZDB-GENE-040724-66
Description:
aquaporin 3b [Source:RefSeq peptide;Acc:NP_001159593]
Human Orthologue:
AQP3
Human Description:
aquaporin 3 (Gill blood group) [Source:HGNC Symbol;Acc:636]
Mouse Orthologue:
Aqp3
Mouse Description:
aquaporin 3 Gene [Source:MGI Symbol;Acc:MGI:1333777]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37266 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101241 Nonsense 274 299 6 6
Genomic Location (Zv9):
Chromosome 21 (position 15500271)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 16952050
GRCz11 21 16988686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGATGGTGTATCAGCTGATGGTGGGATGCCATGTGAAAGGAGAAGAA[A/T]GAGATAAAAGAGAAGCGGTGGAAAGAGAAGAGAAGGAAAGACTCAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link