
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bbs10
- Ensembl ID:
- ENSDARG00000069515
- ZFIN ID:
- ZDB-GENE-060503-355
- Description:
- Bardet-Biedl syndrome 10 [Source:RefSeq peptide;Acc:NP_001082932]
- Human Orthologue:
- BBS10
- Human Description:
- Bardet-Biedl syndrome 10 [Source:HGNC Symbol;Acc:26291]
- Mouse Orthologue:
- Bbs10
- Mouse Description:
- Bardet-Biedl syndrome 10 (human) Gene [Source:MGI Symbol;Acc:MGI:1919019]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa28976 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39189 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa28976
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101238 | Nonsense | 2 | 565 | 3 | 4 |
ENSDART00000122549 | Nonsense | 4 | 567 | 2 | 3 |
ENSDART00000141069 | None | 151 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 18 (position 6843045)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7420735 GRCz11 18 7379670 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACTATATATATATATTTGTGTGTGTGTGTGTGTTTATGTGTGTAGATG[C/T]AGCAGCAGCTGGAATGTGTGTCTCTGCAGGTGTGTGTGAGTGTTCTCGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39189
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101238 | Nonsense | 251 | 565 | 4 | 4 |
ENSDART00000122549 | Nonsense | 253 | 567 | 3 | 3 |
ENSDART00000141069 | None | 151 | None | 2 |
- Genomic Location (Zv9):
- Chromosome 18 (position 6840537)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 7418227 GRCz11 18 7377162 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGACTGAATTGCGAGGTCCAATAAAAGCGCTAGTTTTATATGAGAGTTTT[G/T]GATCATCTCTTGGTGATAATATAACCGTATGCTTTCAGCAAGACTGGTTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: