wbscr27

Ensembl ID:
ENSDARG00000069507
ZFIN ID:
ZDB-GENE-060421-5918
Description:
Williams-Beuren syndrome chromosomal region 27 protein [Source:RefSeq peptide;Acc:NP_001035471]
Human Orthologue:
WBSCR27
Human Description:
Williams Beuren syndrome chromosome region 27 [Source:HGNC Symbol;Acc:19068]
Mouse Orthologue:
Wbscr27
Mouse Description:
Williams Beuren syndrome chromosome region 27 (human) Gene [Source:MGI Symbol;Acc:MGI:1933146]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43656 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43656
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101219 Nonsense 83 235 3 6

The following transcripts of ENSDARG00000069507 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25179403)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25762740
GRCz11 21 25799345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTTTCAACGATGACAGAGAGAAGGCCACTGTTCTGGATGTGGCCTGT[G/T]GAACAGGACTGGTCTCCAAACACGTAAGTATTGCTTCATTTGGATTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link