abhd11

Ensembl ID:
ENSDARG00000069501
ZFIN ID:
ZDB-GENE-040909-1
Description:
Abhydrolase domain-containing protein 11 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRD9]
Human Orthologue:
ABHD11
Human Description:
abhydrolase domain containing 11 [Source:HGNC Symbol;Acc:16407]
Mouse Orthologue:
Abhd11
Mouse Description:
abhydrolase domain containing 11 Gene [Source:MGI Symbol;Acc:MGI:1916008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43653 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37320 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43653
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101208 Essential Splice Site 52 317 None 6

The following transcripts of ENSDARG00000069501 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25102623)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25685960
GRCz11 21 25722565
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCTCGCGGCTGGACCGCGCTGGCAGTGACAGCATGAGAACCGCCAGG[T/C]GTTGCATCTTTAATCTTCCGGATGAAATATTGTTAATTGCACAGAACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101208 Nonsense 104 317 3 6

The following transcripts of ENSDARG00000069501 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25095889)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25679226
GRCz11 21 25715831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTGTCCTGACTGTACTTTGTCTAGTTAGGTGCTGACAATCGATGCT[C/T]GAAACCACGGCAAAAGCCCACACAGCCCTGTCTTGACCTACGACACAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link