zgc:103658

Ensembl ID:
ENSDARG00000069496
ZFIN ID:
ZDB-GENE-041010-19
Description:
ADP-ribosylation factor-like 2 [Source:RefSeq peptide;Acc:NP_001005947]
Human Orthologue:
ARL2
Human Description:
ADP-ribosylation factor-like 2 [Source:HGNC Symbol;Acc:693]
Mouse Orthologue:
Arl2
Mouse Description:
ADP-ribosylation factor-like 2 Gene [Source:MGI Symbol;Acc:MGI:1928393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13269 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077191 Essential Splice Site 113 184 None 5

The following transcripts of ENSDARG00000069496 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 26215028)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24776780
GRCz11 7 25047937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACTGGACGACTGCAGAAAAGAGCTGAATGCYTTACTACTAGAAGAGG[T/A]GTRATGGCGTTTCTCTTAAATTTTATAGCCTTAGTCTATGAAATGTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link