
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-17e16.16
- Ensembl ID:
- ENSDARG00000069495
- ZFIN ID:
- ZDB-GENE-091204-145
- Human Orthologue:
- TMEM179B
- Human Description:
- transmembrane protein 179B [Source:HGNC Symbol;Acc:33744]
- Mouse Orthologue:
- Tmem179b
- Mouse Description:
- transmembrane protein 179B Gene [Source:MGI Symbol;Acc:MGI:1914956]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23945 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23945
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101202 | Essential Splice Site | 172 | 222 | None | 5 |
ENSDART00000148236 | Essential Splice Site | 172 | 222 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 21 (position 25044608)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 25627945 GRCz11 21 25664550 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGTTTTGATTTGTTTTTAATACAGTGTAAATTCTGTTCTCTCCTCCAC[A/T]GAGGTCTATGTGGGTCAGCTTCTTCTTCTGGATATTAATAACGGCCGTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: