zgc:153610

Ensembl ID:
ENSDARG00000069489
ZFIN ID:
ZDB-GENE-060929-132
Description:
hypothetical protein LOC767763 [Source:RefSeq peptide;Acc:NP_001070198]
Human Orthologue:
EXOC6B
Human Description:
exocyst complex component 6B [Source:HGNC Symbol;Acc:17085]
Mouse Orthologue:
Exoc6b
Mouse Description:
exocyst complex component 6B Gene [Source:MGI Symbol;Acc:MGI:1923164]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34065 Nonsense Available for shipment Available now
sa40885 Nonsense Mutation detected in F1 DNA During 2018
sa40886 Nonsense Mutation detected in F1 DNA During 2018
sa34066 Nonsense Mutation detected in F1 DNA During 2018
sa20933 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052773 Nonsense 129 224 5 7
ENSDART00000101188 Nonsense 158 804 6 22
Genomic Location (Zv9):
Chromosome 7 (position 26338733)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24900485
GRCz11 7 25171642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCCTTCCTACACCAGATACTACCCAGCACTACGGACCCTGGAACAGT[T/A]GGAGGAGAGCTGTTTGCCTCAAGCAGGATCCTATCGTTTCTGCACCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052773   None 224 None 7
ENSDART00000101188 Nonsense 418 804 13 22
Genomic Location (Zv9):
Chromosome 7 (position 26386205)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24947957
GRCz11 7 25219114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTGCAGGGTTATGGCTTTCCAGTAAACCAGTTGTTCGACATGTTGT[T/A]GGAGATGAGGGATCAATATGGAGAGATCCTGCTGAAAAAGTGGTCCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052773   None 224 None 7
ENSDART00000101188 Nonsense 536 804 16 22
Genomic Location (Zv9):
Chromosome 7 (position 26398242)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24959988
GRCz11 7 25231145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGTAAATCTACAAATCTCCTGCTTACGCGAACTCTTAGCCACTGCCTA[C/T]AGTATGCCATTAAGAAGAAAAACGTAGGACTGGCAGAGGTGAGTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052773   None 224 None 7
ENSDART00000101188 Nonsense 634 804 18 22
Genomic Location (Zv9):
Chromosome 7 (position 26402657)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24964403
GRCz11 7 25235560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGATTATGATTGGACAGCAGCACAGGGTGGTGGGCAGGCCAGTGACTA[C/A]CTGAGTGACCTCATCGCTTTTCTCTGTAGCACCTTTGCAGTGTTTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052773   None 224 None 7
ENSDART00000101188 Essential Splice Site 700 804 19 22
Genomic Location (Zv9):
Chromosome 7 (position 26418684)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24980430
GRCz11 7 25251587
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTATGGGAGCCCTGCAGCAGTTCAACGTGGACGTCAAAGAATGTGAAA[G/A]TAAGTTTGACTTTTAGCAACAAAAACCCATCTTAAACCTGATTGCATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link