si:dkey-83f4.1

Ensembl ID:
ENSDARG00000069484
ZFIN ID:
ZDB-GENE-081104-516
Description:
Novel protein similar to vertebrate DAB2 interacting protein (DAB2IP) [Source:UniProtKB/TrEMBL;Acc:B
Human Orthologue:
DAB2IP
Human Description:
DAB2 interacting protein [Source:HGNC Symbol;Acc:17294]
Mouse Orthologue:
Dab2ip
Mouse Description:
disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI Symbol;Acc:MGI:1916851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41139 Nonsense Mutation detected in F1 DNA During 2018
sa9948 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Nonsense 250 1162 6 16
ENSDART00000135812 Nonsense 237 1147 5 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12700598)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12145361
GRCz11 8 12183066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGCCCTCGGTCAAGAGCATCACCGTTCATCTTTACAAGGAAACGGAC[A/T]AAAAGAAAAAGAAGGACAAAAATAATTATGTGGGCCTGGTCAATATTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091612 Essential Splice Site 359 1162 6 16
ENSDART00000135812 Essential Splice Site 346 1147 5 15

The following transcripts of ENSDARG00000069484 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12700267)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 12145030
GRCz11 8 12182735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCGTGTGCACTTGTRCATATCTTACAAAGCACAGGCAAGGCCAAGG[T/C]AAGACCACTGCTTTTATAACTCATCGCGTATTATGCATGATTTATCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link