zgc:153795

Ensembl ID:
ENSDARG00000069476
ZFIN ID:
ZDB-GENE-061013-323
Description:
hypothetical protein LOC562009 [Source:RefSeq peptide;Acc:NP_001070718]
Human Orthologue:
SPINT2
Human Description:
serine peptidase inhibitor, Kunitz type, 2 [Source:HGNC Symbol;Acc:11247]
Mouse Orthologue:
Spint2
Mouse Description:
serine protease inhibitor, Kunitz type 2 Gene [Source:MGI Symbol;Acc:MGI:1338031]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6371 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101152 Nonsense 284 431 6 9
Genomic Location (Zv9):
Chromosome 15 (position 19207203)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20309829
GRCz11 15 20245561
KASP Assay ID:
554-5228.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGARATTCTGACTTTGTGTGTTTGCATCCCAGTGAAGATCATTCCCAAA[G/T]AACAGGAGGGCCCTGTCATTCCWGCTATTCCAAAAAGTGCCCACASCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link