
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153795
- Ensembl ID:
- ENSDARG00000069476
- ZFIN ID:
- ZDB-GENE-061013-323
- Description:
- hypothetical protein LOC562009 [Source:RefSeq peptide;Acc:NP_001070718]
- Human Orthologue:
- SPINT2
- Human Description:
- serine peptidase inhibitor, Kunitz type, 2 [Source:HGNC Symbol;Acc:11247]
- Mouse Orthologue:
- Spint2
- Mouse Description:
- serine protease inhibitor, Kunitz type 2 Gene [Source:MGI Symbol;Acc:MGI:1338031]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6371 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa6371
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000101152 | Nonsense | 284 | 431 | 6 | 9 |
- Genomic Location (Zv9):
- Chromosome 15 (position 19207203)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 20309829 GRCz11 15 20245561 - KASP Assay ID:
- 554-5228.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGARATTCTGACTTTGTGTGTTTGCATCCCAGTGAAGATCATTCCCAAA[G/T]AACAGGAGGGCCCTGTCATTCCWGCTATTCCAAAAAGTGCCCACASCTTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: